Home Research COVID-19 Services Publications People Teaching Job Opening News Forum Lab Only
Online Services

●I-TASSER ●D-I-TASSER ●I-TASSER-MTD ●C-I-TASSER ●CR-I-TASSER ●QUARK ●C-QUARK ●D-QUARK ●DRfold ●DRfold2 ●LOMETS ●MUSTER ●CEthreader ●SEGMER ●DeepFold ●DeepFoldRNA ●FoldDesign ●COFACTOR ●COACH ●MetaGO ●TripletGO ●IonCom ●FG-MD ●ModRefiner ●REMO ●DEMO ●DEMO-EM ●DMFold ●SPRING ●COTH ●Threpp ●PEPPI ●BSpred ●ANGLOR ●EDock ●BSP-SLIM ●SAXSTER ●FUpred ●ThreaDom ●ThreaDomEx ●EvoDesign ●BindProf ●BindProfX ●SSIPe ●GPCR-I-TASSER ●MAGELLAN ●ResQ ●STRUM ●DAMpred ●TCRfinder

●TM-score ●TM-align ●US-align ●MM-align ●RNA-align ●NW-align ●LS-align ●EDTSurf ●MVP ●MVP-Fit ●SPICKER ●HAAD ●PSSpred ●3DRobot ●MR-REX ●I-TASSER-MR ●SVMSEQ ●NeBcon ●ResPRE ●TripletRes ●DeepPotential ●WDL-RF ●ATPbind ●DockRMSD ●DeepMSA ●DeepMSA2 ●FASPR ●EM-Refiner ●GPU-I-TASSER

●BioLiP ●E. coli ●GLASS ●GPCR-HGmod ●GPCR-RD ●GPCR-EXP ●Tara-3D ●TM-fold ●DECOYS ●POTENTIAL ●RW/RWplus ●EvoEF ●HPSF ●THE-DB ●ADDRESS ●Alpaca-Antibody ●CASP7 ●CASP8 ●CASP9 ●CASP10 ●CASP11 ●CASP12 ●CASP13 ●CASP14

BioLiP Library
>rna
gccgaggugguggaauugguagacacgcuaccuugaggugguagugcgcuuacggguucaagucccguccucgguacca

The query sequence (length=79) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

# Hit Hit
length 		Aligned
length 		Identity
(normalized by query) 		Identity
(normalized by hit) 		Identity (normalized
by aligned length) 		E-value Homologs
to hit
1 4wsm:2K 79 79 1.0000 1.0000 1.0000 1.01e-36
2 4wsm:2L 80 80 1.0000 0.9875 0.9875 4.68e-35
3 4wsm:3K 77 79 0.9747 1.0000 0.9747 7.83e-33
4 2nr0:G 67 67 0.8481 1.0000 1.0000 4.71e-30
5 2nr0:F 72 72 0.8861 0.9722 0.9722 6.10e-29
6 6ha8:x 75 79 0.9494 1.0000 0.9494 6.10e-29
7 6d90:3 87 87 1.0000 0.9080 0.9080 1.32e-25 6d9j:3, 6ha1:x, 6htq:v, 5kcr:1x, 7nso:8, 7nsp:8, 7nsq:8, 4v87:BB, 4v87:CB, 4v8b:AB, 4v8c:CB, 4v8c:DB, 4wsm:1K, 4wsm:1L
8 2nr0:E 81 81 0.9241 0.9012 0.9012 2.86e-22
9 2nr0:H 65 71 0.7975 0.9692 0.8873 1.04e-16
10 2nre:F 56 28 0.3544 0.5000 1.0000 2.26e-08

[Back]
Reference:
  • Chengxin Zhang, Xi Zhang, Peter L Freddolino, and Yang Zhang. BioLiP2: an updated structure database for biologically relevent ligand-protein interactions, Nucleic Acids Research, gkad630 (2023)(download the PDF file).
  • Jianyi Yang, Ambrish Roy, and Yang Zhang. BioLiP: a semi-manually curated database for biologically relevant ligand-protein interactions, Nucleic Acids Research, 41: D1096-D1103 (2013) (download the PDF file).

zhanglabzhanggroup.org | +65-6601-1241 | Computing 1, 13 Computing Drive, Singapore 117417