gccgaggugguggaauugguagacacgcuaccuugaggugguagugcccaauagggcuuacggguucaagucccguccuc
gguacca
The query sequence (length=87) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 6d90:3 | 87 | 87 | 1.0000 | 1.0000 | 1.0000 | 4.07e-41 | 6d9j:3, 6ha1:x, 6htq:v, 5kcr:1x, 7nso:8, 7nsp:8, 7nsq:8, 4v87:BB, 4v87:CB, 4v8b:AB, 4v8c:CB, 4v8c:DB, 4wsm:1K, 4wsm:1L |
| 2 | 2nr0:E | 81 | 81 | 0.9310 | 1.0000 | 1.0000 | 8.82e-38 | |
| 3 | 4wsm:2L | 80 | 87 | 0.9195 | 1.0000 | 0.9195 | 3.22e-27 | |
| 4 | 4wsm:2K | 79 | 87 | 0.9080 | 1.0000 | 0.9080 | 1.50e-25 | |
| 5 | 2nr0:F | 72 | 79 | 0.8276 | 1.0000 | 0.9114 | 9.00e-23 | |
| 6 | 4wsm:3K | 77 | 87 | 0.8851 | 1.0000 | 0.8851 | 1.16e-21 | |
| 7 | 2nr0:G | 67 | 75 | 0.7701 | 1.0000 | 0.8933 | 7.01e-19 | |
| 8 | 6ha8:x | 75 | 45 | 0.5172 | 0.6000 | 1.0000 | 9.07e-18 | |
| 9 | 2nr0:H | 65 | 77 | 0.7471 | 1.0000 | 0.8442 | 3.28e-12 | |
| 10 | 2nre:F | 56 | 28 | 0.3218 | 0.5000 | 1.0000 | 2.56e-08 |
umich.edu