gcccggaugguggaaucgguagacacaagggaucccucggcguucgcgcugugcggguucaagucccgcuccggguacca
The query sequence (length=80) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 4ari:B | 80 | 80 | 1.0000 | 1.0000 | 1.0000 | 2.84e-37 | 3zju:B |
2 | 3zjt:B | 83 | 82 | 1.0000 | 0.9639 | 0.9756 | 1.71e-34 | |
3 | 3zgz:B | 82 | 81 | 0.9875 | 0.9634 | 0.9753 | 6.16e-34 | |
4 | 5onh:E | 83 | 83 | 1.0000 | 0.9639 | 0.9639 | 7.96e-33 | |
5 | 4as1:B | 83 | 83 | 1.0000 | 0.9639 | 0.9639 | 7.96e-33 | |
6 | 4aq7:B | 79 | 81 | 0.9750 | 0.9873 | 0.9630 | 1.03e-31 | 4cqn:E, 5on3:B, 5on3:E |
7 | 4arc:B | 71 | 68 | 0.8500 | 0.9577 | 1.0000 | 1.33e-30 | |
8 | 3zjv:B | 85 | 85 | 1.0000 | 0.9412 | 0.9412 | 4.79e-30 | |
9 | 3zgz:E | 80 | 81 | 0.9625 | 0.9625 | 0.9506 | 4.79e-30 | |
10 | 8pot:B | 84 | 84 | 0.9875 | 0.9405 | 0.9405 | 1.72e-29 | |
11 | 5on2:E | 81 | 83 | 0.9750 | 0.9630 | 0.9398 | 6.20e-29 | |
12 | 4cqn:B | 82 | 84 | 0.9750 | 0.9512 | 0.9286 | 8.02e-28 | 5onh:B |
13 | 4aq7:E | 77 | 81 | 0.9500 | 0.9870 | 0.9383 | 8.02e-28 | 5omw:E |
14 | 5omw:B | 83 | 85 | 0.9750 | 0.9398 | 0.9176 | 3.73e-26 | |
15 | 5on2:B | 85 | 87 | 0.9750 | 0.9176 | 0.8966 | 2.25e-23 | |
16 | 2nqp:F | 71 | 75 | 0.8500 | 0.9577 | 0.9067 | 1.35e-20 |