gccaagctttttaacagtggccttattaaatgacttctccgctaatac
The query sequence (length=48) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8yeo:T | 48 | 48 | 1.0000 | 1.0000 | 1.0000 | 8.61e-20 | |
| 2 | 8yb6:C | 61 | 35 | 0.7292 | 0.5738 | 1.0000 | 1.45e-12 | 8yha:C |
| 3 | 8ydb:C | 60 | 34 | 0.7083 | 0.5667 | 1.0000 | 5.22e-12 | 8yeo:C, 8yh9:C |
| 4 | 8w1p:R | 61 | 34 | 0.7083 | 0.5574 | 1.0000 | 5.22e-12 | |
| 5 | 8ydb:T | 32 | 32 | 0.6667 | 1.0000 | 1.0000 | 6.75e-11 | |
| 6 | 8fcj:M | 63 | 30 | 0.6250 | 0.4762 | 1.0000 | 8.74e-10 | 8fcu:M, 8fd2:M, 8fd3:M, 8ff4:M, 8ff5:M |
umich.edu