gcaaccauucaaauauguaugcuggagcagcccccgauuuguggggugauuacagc
The query sequence (length=56) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 7vtn:B | 56 | 56 | 1.0000 | 1.0000 | 1.0000 | 3.90e-24 | |
| 2 | 7vti:B | 40 | 40 | 0.7143 | 1.0000 | 1.0000 | 3.06e-15 | |
| 3 | 8fti:B | 97 | 36 | 0.6429 | 0.3711 | 1.0000 | 5.11e-13 |
zhanggroup.org