gaaucucuuugaaguguaguaucuguucuuuucaguguaacaacugaaaugaccuaggcucauacacauuuuuuggcagg
acgggaagaggagacgucgcgacccucgcacgagucguucuugacuuggucgcuugauguuucuucuucccguuc
The query sequence (length=155) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 5nrl:2 | 155 | 155 | 1.0000 | 1.0000 | 1.0000 | 1.28e-78 | |
2 | 6g90:2 | 143 | 144 | 0.9226 | 1.0000 | 0.9931 | 2.78e-70 | |
3 | 7oqb:2 | 143 | 144 | 0.9097 | 0.9860 | 0.9792 | 2.17e-66 | 7oqe:2 |
4 | 5zwo:H | 150 | 156 | 0.9613 | 0.9933 | 0.9551 | 2.80e-65 | |
5 | 7dco:H | 169 | 145 | 0.8968 | 0.8225 | 0.9586 | 2.18e-61 | |
6 | 5lj3:Z | 171 | 153 | 0.8710 | 0.7895 | 0.8824 | 1.73e-42 | 5lj5:Z |
7 | 5zwm:H | 206 | 92 | 0.5677 | 0.4272 | 0.9565 | 8.13e-36 | |
8 | 5zwm:H | 206 | 65 | 0.4000 | 0.3010 | 0.9538 | 1.78e-22 | |
9 | 5mq0:2 | 155 | 144 | 0.8000 | 0.8000 | 0.8611 | 3.78e-34 | |
10 | 6bk8:2 | 135 | 77 | 0.4710 | 0.5407 | 0.9481 | 1.77e-27 | |
11 | 6j6h:L | 209 | 69 | 0.4129 | 0.3062 | 0.9275 | 2.31e-21 | |
12 | 6exn:2 | 136 | 49 | 0.3097 | 0.3529 | 0.9796 | 1.80e-17 | |
13 | 6exn:2 | 136 | 28 | 0.1806 | 0.2059 | 1.0000 | 5.07e-08 | |
14 | 5lqw:2 | 81 | 44 | 0.2839 | 0.5432 | 1.0000 | 6.46e-17 | |
15 | 6j6q:L | 210 | 56 | 0.3290 | 0.2429 | 0.9107 | 1.40e-13 | |
16 | 5gm6:L | 66 | 37 | 0.2387 | 0.5606 | 1.0000 | 5.03e-13 |