cuuaaagagucaacccuuugcuuaucuucccuauuuaaauguuagcagccgcauaggcug
The query sequence (length=60) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8k0k:J | 60 | 60 | 1.0000 | 1.0000 | 1.0000 | 2.57e-26 | 8k22:P, 8k23:P, 8k23:p, 8k24:p, 8k24:P, 8k27:P, 8k29:P |
| 2 | 8k28:P | 59 | 59 | 0.9833 | 1.0000 | 1.0000 | 9.26e-26 | |
| 3 | 7wwv:M | 39 | 39 | 0.6500 | 1.0000 | 1.0000 | 1.21e-14 | |
| 4 | 7wwu:M | 50 | 54 | 0.8167 | 0.9800 | 0.9074 | 5.65e-13 |
zhanggroup.org