cuccgaacgguaagagccuagcauguagaaugaugucauacuuaucc
The query sequence (length=47) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 8i0p:G | 63 | 47 | 1.0000 | 0.7460 | 1.0000 | 3.00e-19 | |
2 | 7abi:Z | 57 | 47 | 1.0000 | 0.8246 | 1.0000 | 3.00e-19 | |
3 | 7abg:Z | 47 | 47 | 1.0000 | 1.0000 | 1.0000 | 3.00e-19 | |
4 | 8qo9:Z | 46 | 46 | 0.9574 | 0.9783 | 0.9783 | 1.80e-16 | |
5 | 9fmd:IN | 42 | 38 | 0.8085 | 0.9048 | 1.0000 | 3.02e-14 | 6qdv:I |
6 | 8i0s:G | 72 | 51 | 1.0000 | 0.6528 | 0.9216 | 1.08e-13 | 8i0t:G |
7 | 8i0r:G | 71 | 51 | 1.0000 | 0.6620 | 0.9216 | 1.08e-13 | |
8 | 5z56:G | 77 | 30 | 0.6383 | 0.3896 | 1.0000 | 8.45e-10 | 5z57:G, 5z58:G |
9 | 5yzg:G | 88 | 30 | 0.6383 | 0.3409 | 1.0000 | 8.45e-10 | |
10 | 5xjc:G | 84 | 30 | 0.6383 | 0.3571 | 1.0000 | 8.45e-10 | |
11 | 8q7n:Z | 31 | 30 | 0.6383 | 0.9677 | 1.0000 | 8.45e-10 | |
12 | 6icz:G | 84 | 30 | 0.6383 | 0.3571 | 1.0000 | 8.45e-10 | |
13 | 8i0u:G | 79 | 30 | 0.6383 | 0.3797 | 1.0000 | 8.45e-10 | 8i0v:G |
14 | 8ch6:g | 76 | 30 | 0.6383 | 0.3947 | 1.0000 | 8.45e-10 | 7qtt:g |
15 | 6ahd:G | 77 | 30 | 0.6383 | 0.3896 | 1.0000 | 8.45e-10 | |
16 | 7aav:Z | 29 | 29 | 0.6170 | 1.0000 | 1.0000 | 3.04e-09 | 7abf:Z |