cuaagaaauucacggcgggcuugauguccgcgucuaccugguucacugccguguaggcag
The query sequence (length=60) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 6uvn:M | 61 | 60 | 1.0000 | 0.9836 | 1.0000 | 2.57e-26 | |
| 2 | 6b44:M | 60 | 60 | 1.0000 | 1.0000 | 1.0000 | 2.57e-26 | 6b45:M, 6b46:M, 6b47:M, 6b48:M, 7ecv:M, 7elm:J, 7elm:T, 7eln:J, 7eln:T, 6w1x:M, 7we6:J, 7we6:T, 6whi:M |
| 3 | 7eqg:M | 58 | 58 | 0.9667 | 1.0000 | 1.0000 | 3.33e-25 | 6ne0:M, 7yhs:M |
| 4 | 5uz9:M | 60 | 60 | 0.9833 | 0.9833 | 0.9833 | 1.20e-24 | 6vqv:L, 6vqx:K |
| 5 | 7jzw:M | 61 | 60 | 0.9667 | 0.9508 | 0.9667 | 5.57e-23 | 7jzx:M, 7jzy:M, 7jzz:M, 7t3j:M, 7t3k:M, 7t3k:m, 7t3l:M, 7t3l:m, 7taw:M, 7taw:m, 7tax:M |
| 6 | 7ecw:M | 44 | 44 | 0.7333 | 1.0000 | 1.0000 | 2.02e-17 | |
| 7 | 6vqw:K | 40 | 40 | 0.6667 | 1.0000 | 1.0000 | 3.38e-15 | |
| 8 | 6lnb:M | 60 | 52 | 0.8000 | 0.8000 | 0.9231 | 3.38e-15 | 6lnc:M |
| 9 | 5xlo:K | 38 | 38 | 0.6333 | 1.0000 | 1.0000 | 4.37e-14 |
zhanggroup.org