cuaagaaauucacggcgggcuugauguccgcgucuaccugguuc
The query sequence (length=44) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 5uz9:M | 60 | 44 | 1.0000 | 0.7333 | 1.0000 | 1.25e-17 | 6vqv:L, 6vqx:K |
| 2 | 6uvn:M | 61 | 44 | 1.0000 | 0.7213 | 1.0000 | 1.25e-17 | |
| 3 | 7eqg:M | 58 | 44 | 1.0000 | 0.7586 | 1.0000 | 1.25e-17 | 6ne0:M, 7yhs:M |
| 4 | 7ecw:M | 44 | 44 | 1.0000 | 1.0000 | 1.0000 | 1.25e-17 | |
| 5 | 6b44:M | 60 | 44 | 1.0000 | 0.7333 | 1.0000 | 1.25e-17 | 6b45:M, 6b46:M, 6b47:M, 6b48:M, 7ecv:M, 7elm:J, 7elm:T, 7eln:J, 7eln:T, 6w1x:M, 7we6:J, 7we6:T, 6whi:M |
| 6 | 7jzw:M | 61 | 44 | 0.9773 | 0.7049 | 0.9773 | 5.81e-16 | 7jzx:M, 7jzy:M, 7jzz:M, 7t3j:M, 7t3k:M, 7t3k:m, 7t3l:M, 7t3l:m, 7taw:M, 7taw:m, 7tax:M |
| 7 | 6vqw:K | 40 | 40 | 0.9091 | 1.0000 | 1.0000 | 2.09e-15 | |
| 8 | 5xlo:K | 38 | 38 | 0.8636 | 1.0000 | 1.0000 | 2.70e-14 | |
| 9 | 6lnb:M | 60 | 37 | 0.8182 | 0.6000 | 0.9730 | 4.53e-12 | 6lnc:M |
zhanggroup.org