cuaagaaauucacggcgggcuugauguccgcgucuaccugauucacugccguauaggcagc
The query sequence (length=61) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 7jzw:M | 61 | 61 | 1.0000 | 1.0000 | 1.0000 | 7.33e-27 | 7jzx:M, 7jzy:M, 7jzz:M, 7t3j:M, 7t3k:M, 7t3k:m, 7t3l:M, 7t3l:m, 7taw:M, 7taw:m, 7tax:M |
2 | 5uz9:M | 60 | 60 | 0.9672 | 0.9833 | 0.9833 | 1.23e-24 | 6vqv:L, 6vqx:K |
3 | 6uvn:M | 61 | 61 | 0.9672 | 0.9672 | 0.9672 | 1.59e-23 | |
4 | 6b44:M | 60 | 60 | 0.9508 | 0.9667 | 0.9667 | 5.70e-23 | 6b45:M, 6b46:M, 6b47:M, 6b48:M, 7ecv:M, 7elm:J, 7elm:T, 7eln:J, 7eln:T, 6w1x:M, 7we6:J, 7we6:T, 6whi:M |
5 | 7eqg:M | 58 | 58 | 0.9180 | 0.9655 | 0.9655 | 7.38e-22 | 6ne0:M, 7yhs:M |
6 | 7ecw:M | 44 | 44 | 0.7049 | 0.9773 | 0.9773 | 9.61e-16 | |
7 | 6vqw:K | 40 | 40 | 0.6557 | 1.0000 | 1.0000 | 3.46e-15 | |
8 | 5xlo:K | 38 | 38 | 0.6230 | 1.0000 | 1.0000 | 4.47e-14 | |
9 | 6lnb:M | 60 | 46 | 0.6885 | 0.7000 | 0.9130 | 7.48e-12 | 6lnc:M |