cguuggcccaggaaacuggguaguaagguccauugcacuccgggccugaagcaacgcu
The query sequence (length=58) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 5ddo:A | 58 | 58 | 1.0000 | 1.0000 | 1.0000 | 3.17e-25 | 5ddo:B |
| 2 | 5ddp:A | 61 | 60 | 0.9483 | 0.9016 | 0.9167 | 6.91e-17 | 5ddp:B, 5ddq:A, 5ddq:B, 5ddr:A, 5ddr:B |
zhanggroup.org