BioLiP

>rna
cgcuucucggcuguaguaucuguucuuaucaguuuaauaucugauagauuuuuggagcaucgaccugguauugcaguacc
uccaggaacggugc

The query sequence (length=94) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	6qx9:2	94	94	1.0000	1.0000	1.0000	5.77e-45
2	8qxd:2	97	97	1.0000	0.9691	0.9691	1.62e-40
3	8qo9:2	98	98	1.0000	0.9592	0.9592	2.09e-39	8qzs:2
4	8r08:2	97	97	0.9894	0.9588	0.9588	7.52e-39	8r0a:2
5	8r09:2	98	98	0.9894	0.9490	0.9490	9.72e-38	8r0b:2, 8rm5:2
6	9fmd:2	120	89	0.8511	0.6667	0.8989	1.65e-25	6qdv:2
7	6ah0:H	109	109	0.9894	0.8532	0.8532	3.57e-22	6ahd:H, 8h6e:2A, 8h6j:2A, 8h6k:2A, 8h6l:2A
8	5z56:H	136	38	0.4043	0.2794	1.0000	7.79e-14	5z57:H, 5z58:H
9	5z56:H	136	34	0.3617	0.2500	1.0000	1.30e-11	5z57:H, 5z58:H
10	6y53:2	98	38	0.4043	0.3878	1.0000	7.79e-14
11	7vpx:H	130	38	0.4043	0.2923	1.0000	7.79e-14
12	7vpx:H	130	32	0.3404	0.2462	1.0000	1.69e-10
13	5o9z:2	100	38	0.4043	0.3800	1.0000	7.79e-14
14	5mqf:2	140	38	0.4043	0.2714	1.0000	7.79e-14
15	5mqf:2	140	29	0.3085	0.2071	1.0000	7.84e-09
16	6id1:H	136	42	0.4362	0.3015	0.9762	7.79e-14
17	6id0:H	140	42	0.4362	0.2929	0.9762	7.79e-14
18	6icz:H	140	38	0.4043	0.2714	1.0000	7.79e-14	7w59:H, 7w5a:H, 7w5b:H, 5xjc:H
19	8i0w:H	139	38	0.4043	0.2734	1.0000	7.79e-14	5yzg:H
20	8i0v:H	151	38	0.4043	0.2517	1.0000	7.79e-14
21	8i0r:H	167	38	0.4043	0.2275	1.0000	7.79e-14	8i0s:H, 8i0t:H, 8i0u:H
22	8i0r:H	167	34	0.3617	0.2036	1.0000	1.30e-11	8i0s:H, 8i0t:H, 8i0u:H
23	8i0p:H	165	38	0.4043	0.2303	1.0000	7.79e-14
24	8i0p:H	165	34	0.3617	0.2061	1.0000	1.30e-11
25	7evo:H	148	38	0.4043	0.2568	1.0000	7.79e-14	8hk1:H, 6y5q:2
26	7evo:H	148	34	0.3617	0.2297	1.0000	1.30e-11	8hk1:H, 6y5q:2
27	8ch6:f	137	38	0.4043	0.2774	1.0000	7.79e-14
28	8ch6:f	137	34	0.3617	0.2482	1.0000	1.30e-11
29	8c6j:2	142	38	0.4043	0.2676	1.0000	7.79e-14
30	8c6j:2	142	29	0.3085	0.2042	1.0000	7.84e-09
31	7abi:2	164	38	0.4043	0.2317	1.0000	7.79e-14
32	7abi:2	164	34	0.3617	0.2073	1.0000	1.30e-11
33	7abg:2	145	38	0.4043	0.2621	1.0000	7.79e-14
34	7a5p:2	155	38	0.4043	0.2452	1.0000	7.79e-14
35	6y50:2	50	34	0.3617	0.6800	1.0000	1.30e-11
36	7qtt:f	76	34	0.3617	0.4474	1.0000	1.30e-11
37	7abh:2	37	34	0.3617	0.9189	1.0000	1.30e-11
38	7q4o:2	35	32	0.3404	0.9143	1.0000	1.69e-10
39	7onb:H	32	32	0.3404	1.0000	1.0000	1.69e-10
40	7q4p:2	45	31	0.3298	0.6889	1.0000	6.06e-10

[Back]