BioLiP

>rna
cgcuucucggccaaguguaguaucuguucuuaucaguuuaauaucugauagauuuuuggagcaucgaccugguauugcag
uaccuccaggaacggugc

The query sequence (length=98) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	8qo9:2	98	98	1.0000	1.0000	1.0000	3.63e-47	8qzs:2
2	8r09:2	98	98	0.9898	0.9898	0.9898	1.69e-45	8r0b:2, 8rm5:2
3	8qxd:2	97	98	0.9898	1.0000	0.9898	6.08e-45
4	8r08:2	97	98	0.9796	0.9897	0.9796	2.83e-43	8r0a:2
5	6qx9:2	94	98	0.9592	1.0000	0.9592	2.20e-39
6	9fmd:2	120	93	0.8571	0.7000	0.9032	1.04e-27	6qdv:2
7	6ah0:H	109	110	0.9796	0.8807	0.8727	1.34e-26	6ahd:H, 8h6e:2A, 8h6j:2A, 8h6k:2A, 8h6l:2A
8	5z56:H	136	38	0.3878	0.2794	1.0000	8.20e-14	5z57:H, 5z58:H
9	5z56:H	136	38	0.3878	0.2794	1.0000	8.20e-14	5z57:H, 5z58:H
10	6y53:2	98	38	0.3878	0.3878	1.0000	8.20e-14
11	6y50:2	50	38	0.3878	0.7600	1.0000	8.20e-14
12	7vpx:H	130	38	0.3878	0.2923	1.0000	8.20e-14
13	7vpx:H	130	32	0.3265	0.2462	1.0000	1.78e-10
14	7qtt:f	76	38	0.3878	0.5000	1.0000	8.20e-14
15	5o9z:2	100	38	0.3878	0.3800	1.0000	8.20e-14
16	5mqf:2	140	38	0.3878	0.2714	1.0000	8.20e-14
17	5mqf:2	140	33	0.3367	0.2357	1.0000	4.94e-11
18	6id1:H	136	42	0.4184	0.3015	0.9762	8.20e-14
19	6id0:H	140	42	0.4184	0.2929	0.9762	8.20e-14
20	6icz:H	140	38	0.3878	0.2714	1.0000	8.20e-14	7w59:H, 7w5a:H, 7w5b:H, 5xjc:H
21	8i0w:H	139	38	0.3878	0.2734	1.0000	8.20e-14	5yzg:H
22	8i0v:H	151	38	0.3878	0.2517	1.0000	8.20e-14
23	8i0r:H	167	38	0.3878	0.2275	1.0000	8.20e-14	8i0s:H, 8i0t:H, 8i0u:H
24	8i0r:H	167	38	0.3878	0.2275	1.0000	8.20e-14	8i0s:H, 8i0t:H, 8i0u:H
25	8i0p:H	165	38	0.3878	0.2303	1.0000	8.20e-14
26	8i0p:H	165	38	0.3878	0.2303	1.0000	8.20e-14
27	7evo:H	148	38	0.3878	0.2568	1.0000	8.20e-14	8hk1:H, 6y5q:2
28	7evo:H	148	38	0.3878	0.2568	1.0000	8.20e-14	8hk1:H, 6y5q:2
29	8ch6:f	137	38	0.3878	0.2774	1.0000	8.20e-14
30	8ch6:f	137	38	0.3878	0.2774	1.0000	8.20e-14
31	8c6j:2	142	38	0.3878	0.2676	1.0000	8.20e-14
32	8c6j:2	142	33	0.3367	0.2324	1.0000	4.94e-11
33	7abi:2	164	38	0.3878	0.2317	1.0000	8.20e-14
34	7abi:2	164	38	0.3878	0.2317	1.0000	8.20e-14
35	7abg:2	145	38	0.3878	0.2621	1.0000	8.20e-14
36	7a5p:2	155	38	0.3878	0.2452	1.0000	8.20e-14
37	7abh:2	37	37	0.3776	1.0000	1.0000	2.95e-13
38	7q4o:2	35	35	0.3571	1.0000	1.0000	3.82e-12
39	7onb:H	32	32	0.3265	1.0000	1.0000	1.78e-10
40	7q4p:2	45	31	0.3163	0.6889	1.0000	6.39e-10

[Back]