cgaggugguggaauugguagacacgcuaccuugaggugguagugccccuuacggguucaagucccguccucg
The query sequence (length=72) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 2nr0:F | 72 | 72 | 1.0000 | 1.0000 | 1.0000 | 6.92e-33 | |
2 | 4wsm:2L | 80 | 72 | 0.9861 | 0.8875 | 0.9861 | 3.22e-31 | |
3 | 4wsm:2K | 79 | 72 | 0.9722 | 0.8861 | 0.9722 | 5.39e-29 | |
4 | 4wsm:3K | 77 | 72 | 0.9583 | 0.8961 | 0.9583 | 9.01e-27 | |
5 | 2nr0:G | 67 | 68 | 0.9167 | 0.9851 | 0.9706 | 9.01e-27 | |
6 | 2nr0:E | 81 | 79 | 1.0000 | 0.8889 | 0.9114 | 7.02e-23 | |
7 | 6ha8:x | 75 | 72 | 0.9306 | 0.8933 | 0.9306 | 7.02e-23 | |
8 | 6d90:3 | 87 | 79 | 1.0000 | 0.8276 | 0.9114 | 7.02e-23 | 6d9j:3, 6ha1:x, 6htq:v, 5kcr:1x, 7nso:8, 7nsp:8, 7nsq:8, 4v87:BB, 4v87:CB, 4v8b:AB, 4v8c:CB, 4v8c:DB, 4wsm:1K, 4wsm:1L |
9 | 2nr0:H | 65 | 71 | 0.8750 | 0.9692 | 0.8873 | 9.14e-17 | |
10 | 2nre:F | 56 | 28 | 0.3889 | 0.5000 | 1.0000 | 1.99e-08 |