cgacucuuagcgguggaucacucggcucgugcgucgaugaagaacgcagcuagcugcgagaauuaaugugaauugcagga
cacauugaucaucgacacuucgaacgcacugcggccccggguuccucccggggcuacgccugucugagcgucgcu
The query sequence (length=155) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 8ine:8 | 155 | 155 | 1.0000 | 1.0000 | 1.0000 | 1.28e-78 | 8ir1:8, 8ir3:8 |
2 | 8inf:8 | 154 | 154 | 0.9935 | 1.0000 | 1.0000 | 4.59e-78 | |
3 | 5aj0:A3 | 157 | 156 | 1.0000 | 0.9873 | 0.9936 | 5.94e-77 | 4d5y:3, 4d67:3, 6gz3:A3, 6gz4:A3, 6gz5:A3, 6ole:D, 6olf:D, 6olg:A3, 6oli:D, 6olz:A3, 6om0:D, 6om7:D, 7qgg:D, 6swa:r, 4ujc:A3, 4ujd:A3, 4uje:A3, 4v6x:A8, 6w6l:D |
4 | 7a01:h2 | 156 | 156 | 1.0000 | 0.9936 | 0.9936 | 5.94e-77 | 7bhp:L8, 8btk:B8, 7cpu:L8, 7cpv:L8, 9f1b:B8, 9f1c:B8, 9f1d:B8, 7f5s:L8, 6frk:8, 6ftg:w, 6fti:w, 6ftj:w, 8g5y:L8, 8g5z:L8, 8g60:L8, 8g61:L8, 8g6j:L8, 8glp:L8, 8idt:8, 8idy:8, 8ie3:8, 8ifd:1C, 8ife:1C, 8ink:8, 6ip5:1C, 6ip6:1C, 6ip8:1C, 8ipd:8, 8ipx:8, 8ipy:8, 3j7o:8, 3j7p:8, 3j7q:8, 3j7r:8, 3j92:8, 3jag:8, 3jah:8, 3jai:8, 3jaj:8, 3jan:8, 8jdj:F, 8jdk:F, 8jdl:F, 8jdm:F, 8k2c:L8, 5lks:L8, 6lqm:8, 6lss:8, 7ls1:C2, 7ls2:C2, 6lu8:8, 7nfx:8, 7nwi:8, 7o7y:B8, 7o7z:B8, 7o80:B8, 7o81:B8, 7obr:8, 8p2k:B8, 8qoi:L8, 7qvp:L1, 7qvp:L8, 7qwq:8, 7qwr:8, 7qws:8, 6qzp:L8, 6r6p:8, 8rjb:v, 8rjc:v, 8rjd:v, 8scb:8, 5t2c:C, 7tm3:v, 7toq:A58S, 7tut:v, 4ug0:L8, 7xnx:L3, 7xny:L3, 8xsx:L8, 8xsy:L8, 8xsz:L8, 6y0g:L8, 8y0w:L8, 8y0x:L8, 6y2l:L8, 6y57:L8, 6y6x:L8, 8yoo:L8, 8yop:L8, 6z6l:L8, 6z6m:L8, 6z6n:L8, 7zjw:L8, 7zjx:L8, 6zm7:L8, 6zme:L8, 6zmi:L8, 6zmo:L8, 6zvk:h2 |
5 | 6xa1:L8 | 155 | 155 | 0.9935 | 0.9935 | 0.9935 | 2.14e-76 | |
6 | 8fky:L1 | 155 | 154 | 0.9871 | 0.9871 | 0.9935 | 7.68e-76 | |
7 | 6lsr:8 | 155 | 156 | 0.9935 | 0.9935 | 0.9872 | 2.76e-75 | |
8 | 8q7z:B8 | 157 | 154 | 0.9806 | 0.9682 | 0.9870 | 3.57e-74 | 8q87:B8 |
9 | 8fkz:L1 | 154 | 156 | 0.9871 | 0.9935 | 0.9808 | 4.62e-73 | 8fl2:L1, 8fl3:L1, 8fl4:L1, 8fl6:L1, 8fl7:L1, 8fl9:L1, 8fla:L1, 8flb:L1, 8flc:L1, 8fld:L1, 8fle:L1, 8flf:L1 |
10 | 8fkr:L1 | 154 | 156 | 0.9806 | 0.9870 | 0.9744 | 2.15e-71 | |
11 | 8fkp:L1 | 152 | 154 | 0.9677 | 0.9868 | 0.9740 | 2.78e-70 | 8fks:L1, 8fkt:L1, 8fku:L1, 8fkv:L1, 8fkw:L1, 8fkx:L1 |
12 | 8b5l:8 | 151 | 156 | 0.9677 | 0.9934 | 0.9615 | 1.67e-67 | 8b6c:8, 9bdl:A58S, 9bdn:A58S, 9bdp:A58S, 8bhf:C2, 8bpo:C1, 6d90:8, 6d9j:8, 6hcf:82, 6hcj:81, 6hcm:82, 6hcq:81, 5lzs:8, 5lzt:8, 5lzu:8, 5lzv:8, 5lzw:8, 5lzx:8, 5lzy:8, 5lzz:8, 7mdz:8, 6mtb:8, 6mtc:8, 6mtd:8, 6mte:8, 7nwg:81, 7nwh:8, 6p5i:8, 6p5j:8, 6p5k:8, 6p5n:8, 6r5q:8, 6r6g:8, 6r7q:8, 6sgc:84, 6t59:84, 7tor:A58S, 7uck:8 |
13 | 7ucj:8 | 150 | 155 | 0.9613 | 0.9933 | 0.9613 | 6.02e-67 | |
14 | 8fkq:L1 | 150 | 154 | 0.9548 | 0.9867 | 0.9610 | 2.17e-66 | |
15 | 8a3d:C | 148 | 156 | 0.9484 | 0.9932 | 0.9423 | 2.18e-61 | 8ohd:8, 8oj0:8, 8oj5:8, 8oj8:8 |
16 | 7oya:81 | 158 | 156 | 0.9355 | 0.9177 | 0.9295 | 1.01e-59 | |
17 | 7ow7:C | 148 | 156 | 0.9419 | 0.9865 | 0.9359 | 1.01e-59 | |
18 | 7oyd:8 | 144 | 154 | 0.9290 | 1.0000 | 0.9351 | 1.31e-58 | |
19 | 8qfd:8 | 144 | 155 | 0.9226 | 0.9931 | 0.9226 | 2.84e-55 | |
20 | 7oyc:81 | 147 | 156 | 0.9161 | 0.9660 | 0.9103 | 1.71e-52 | |
21 | 7oyb:81 | 150 | 154 | 0.9032 | 0.9333 | 0.9091 | 1.71e-52 | |
22 | 8bf9:8 | 98 | 79 | 0.4839 | 0.7653 | 0.9494 | 1.37e-28 | |
23 | 4v5z:B1 | 97 | 67 | 0.4258 | 0.6804 | 0.9851 | 1.77e-27 | |
24 | 9fpz:8 | 58 | 58 | 0.3742 | 1.0000 | 1.0000 | 1.07e-24 | 9fq0:8, 8ony:8, 6sxo:L8 |