cagaacaccuaauuucgaauccagcaugagaagc
The query sequence (length=34) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 8z4j:N | 34 | 34 | 1.0000 | 1.0000 | 1.0000 | 2.96e-12 | 8z9e:N |
2 | 8z9c:N | 41 | 29 | 0.8529 | 0.7073 | 1.0000 | 1.78e-09 | |
3 | 8z99:N | 46 | 29 | 0.8529 | 0.6304 | 1.0000 | 1.78e-09 | |
4 | 8z4l:N | 40 | 29 | 0.8529 | 0.7250 | 1.0000 | 1.78e-09 | |
5 | 8yhe:N | 30 | 29 | 0.8529 | 0.9667 | 1.0000 | 1.78e-09 | |
6 | 8yhd:N | 35 | 29 | 0.8529 | 0.8286 | 1.0000 | 1.78e-09 | |
7 | 8z9e:M | 39 | 28 | 0.8235 | 0.7179 | 1.0000 | 6.42e-09 | |
8 | 8z9c:M | 48 | 28 | 0.8235 | 0.5833 | 1.0000 | 6.42e-09 | |
9 | 8z99:M | 54 | 28 | 0.8235 | 0.5185 | 1.0000 | 6.42e-09 | |
10 | 8z4l:M | 49 | 28 | 0.8235 | 0.5714 | 1.0000 | 6.42e-09 | |
11 | 8z4j:M | 38 | 28 | 0.8235 | 0.7368 | 1.0000 | 6.42e-09 | |
12 | 8yhe:M | 46 | 28 | 0.8235 | 0.6087 | 1.0000 | 6.42e-09 | |
13 | 8yhd:M | 53 | 28 | 0.8235 | 0.5283 | 1.0000 | 6.42e-09 |