auuuuugugcccaucguuggcacuauuaaggaauggaauauag
The query sequence (length=43) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 7d2l:B | 43 | 43 | 1.0000 | 1.0000 | 1.0000 | 4.32e-17 | 7d3j:B, 7eu9:B |
2 | 7d8c:B | 38 | 38 | 0.8837 | 1.0000 | 1.0000 | 2.60e-14 |