auugaaaguucaaagcuuagauacccuggagggaaaccagacuuaacacca
The query sequence (length=51) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 6s6b:V | 51 | 51 | 1.0000 | 1.0000 | 1.0000 | 2.04e-21 | |
2 | 6s8b:V | 49 | 49 | 0.9608 | 1.0000 | 1.0000 | 2.63e-20 | 6shb:V |
3 | 6s91:V | 48 | 48 | 0.9412 | 1.0000 | 1.0000 | 9.48e-20 | 6sh8:V, 6sic:V |
4 | 6s8e:V | 47 | 47 | 0.9216 | 1.0000 | 1.0000 | 3.41e-19 | |
5 | 6s8e:U | 44 | 44 | 0.8627 | 1.0000 | 1.0000 | 1.59e-17 | |
6 | 6sic:U | 42 | 39 | 0.7647 | 0.9286 | 1.0000 | 9.54e-15 | |
7 | 6shb:U | 43 | 39 | 0.7647 | 0.9070 | 1.0000 | 9.54e-15 | |
8 | 6s8b:U | 44 | 39 | 0.7647 | 0.8864 | 1.0000 | 9.54e-15 | |
9 | 6s91:U | 36 | 32 | 0.6275 | 0.8889 | 1.0000 | 7.43e-11 | |
10 | 6sh8:U | 32 | 29 | 0.5686 | 0.9062 | 1.0000 | 3.46e-09 |