auucaaagguuguggguucgaaucccaccagagucgg
The query sequence (length=37) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8hmz:3 | 37 | 37 | 1.0000 | 1.0000 | 1.0000 | 7.11e-14 | |
| 2 | 8hmy:T | 90 | 37 | 1.0000 | 0.4111 | 1.0000 | 7.11e-14 | |
| 3 | 7uxa:E | 78 | 36 | 0.9730 | 0.4615 | 1.0000 | 2.56e-13 | |
| 4 | 8uau:R | 76 | 36 | 0.9730 | 0.4737 | 1.0000 | 2.56e-13 | |
| 5 | 8iss:E | 80 | 36 | 0.9730 | 0.4500 | 1.0000 | 2.56e-13 |
umich.edu