aucuuaacccaauuuuuugagccuugccuuggcaaggcua
The query sequence (length=40) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 7a5p:5 | 40 | 40 | 1.0000 | 1.0000 | 1.0000 | 1.77e-15 | |
2 | 7abg:5 | 114 | 39 | 0.9750 | 0.3421 | 1.0000 | 6.36e-15 | 7abi:5, 5mqf:5, 5o9z:5 |
3 | 8c6j:5 | 113 | 38 | 0.9500 | 0.3363 | 1.0000 | 2.29e-14 | |
4 | 9fmd:5 | 92 | 35 | 0.8500 | 0.3696 | 0.9714 | 1.78e-10 | 8ro2:5 |