agcuuugcgcaguggcaguaucguagccaaugaggucuauccgaggcgcgauuauugcuaauu
The query sequence (length=63) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 8r09:4 | 128 | 63 | 1.0000 | 0.4922 | 1.0000 | 5.79e-28 | 8r0b:4 |
2 | 8qpe:4 | 63 | 63 | 1.0000 | 1.0000 | 1.0000 | 5.79e-28 | |
3 | 8qoz:4 | 80 | 63 | 1.0000 | 0.7875 | 1.0000 | 5.79e-28 | 8qpb:4 |
4 | 8h6k:4A | 128 | 63 | 1.0000 | 0.4922 | 1.0000 | 5.79e-28 | 8h6l:4A |
5 | 6ahd:I | 136 | 63 | 1.0000 | 0.4632 | 1.0000 | 5.79e-28 | 8qzs:4 |
6 | 8rm5:4 | 110 | 62 | 0.9841 | 0.5636 | 1.0000 | 2.08e-27 | |
7 | 8qpa:4 | 62 | 62 | 0.9841 | 1.0000 | 1.0000 | 2.08e-27 | |
8 | 8qo9:4 | 127 | 62 | 0.9841 | 0.4882 | 1.0000 | 2.08e-27 | |
9 | 5o9z:4 | 137 | 63 | 0.9841 | 0.4526 | 0.9841 | 2.69e-26 | |
10 | 8q7n:4 | 76 | 62 | 0.9683 | 0.8026 | 0.9839 | 9.68e-26 | |
11 | 8h6j:4A | 125 | 63 | 0.9841 | 0.4960 | 0.9841 | 9.68e-26 | |
12 | 8qxd:4 | 124 | 63 | 0.9683 | 0.4919 | 0.9683 | 4.50e-24 | 8r08:4, 8r0a:4 |
13 | 8qp8:4 | 76 | 63 | 0.9683 | 0.8026 | 0.9683 | 4.50e-24 | 8qp9:4, 8qpk:4 |
14 | 8h6e:4A | 125 | 63 | 0.9683 | 0.4880 | 0.9683 | 4.50e-24 | |
15 | 6qw6:4 | 125 | 63 | 0.9524 | 0.4800 | 0.9524 | 2.10e-22 | 6qx9:4 |
16 | 6ah0:I | 117 | 53 | 0.8095 | 0.4359 | 0.9623 | 1.63e-18 |