BioLiP

>rna
acucugguuucucuucagaucgcauaaaucuuucgccuuuuacuaaagauuuccguggagaggaacaacucugaguc

The query sequence (length=77) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	8r09:5	112	77	1.0000	0.6875	1.0000	1.26e-35	8r0b:5, 8rm5:5
2	8qzs:5	109	77	1.0000	0.7064	1.0000	1.26e-35	8y6o:B
3	8qpk:5	77	77	1.0000	1.0000	1.0000	1.26e-35
4	8qoz:5	79	77	1.0000	0.9747	1.0000	1.26e-35	8qpa:5, 8qpb:5
5	8c6j:5	113	77	1.0000	0.6814	1.0000	1.26e-35
6	6ah0:B	115	77	1.0000	0.6696	1.0000	1.26e-35	6ahd:B, 8h6k:5A, 8h6l:5A, 8q7n:5, 8qo9:5, 8qpe:5, 8r0a:5
7	7abg:5	114	77	1.0000	0.6754	1.0000	1.26e-35	7abi:5, 5mqf:5, 5o9z:5
8	8h6e:5A	114	76	0.9870	0.6667	1.0000	4.53e-35	8h6j:5A
9	6zym:5	74	74	0.9610	1.0000	1.0000	5.85e-34
10	6id0:B	98	73	0.9481	0.7449	1.0000	2.11e-33	6id1:B
11	6icz:B	97	72	0.9351	0.7423	1.0000	7.57e-33
12	6ff4:5	70	70	0.9091	1.0000	1.0000	9.80e-32	6ff7:5
13	7aav:5	69	69	0.8961	1.0000	1.0000	3.52e-31
14	8ch6:e	98	70	0.8961	0.7041	0.9857	1.64e-29	7qtt:e
15	7w59:B	84	64	0.8312	0.7619	1.0000	2.12e-28	7w5a:B, 7w5b:B, 5xjc:B, 5yzg:B, 5z56:B, 5z57:B, 5z58:B
16	8i0p:B	98	64	0.8312	0.6531	1.0000	2.12e-28	8i0r:B, 8i0s:B, 8i0t:B, 8i0u:B, 8i0v:B, 8i0w:B
17	7dvq:B	90	64	0.8312	0.7111	1.0000	2.12e-28
18	6qdv:5	75	63	0.8182	0.8400	1.0000	7.63e-28
19	9fmd:5	92	61	0.7922	0.6630	1.0000	9.87e-27	8ro2:5
20	8q7q:5	104	77	0.9351	0.6923	0.9351	1.28e-25	8q7v:5, 8q7w:5, 8q7x:5, 8q91:5, 6qw6:5, 6qx9:5, 8qxd:5, 8r08:5, 8rc0:5
21	8qp8:5	71	76	0.9221	1.0000	0.9342	4.59e-25	8qp9:5
22	7abf:5	58	58	0.7532	1.0000	1.0000	4.59e-25
23	8ro1:5	111	52	0.5974	0.4144	0.8846	3.62e-11
24	8ro0:5	111	52	0.5974	0.4144	0.8846	3.62e-11

[Back]