acggaaacgcuuucuagcucgcuauaauuaccca
The query sequence (length=34) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 6ifl:I | 35 | 34 | 1.0000 | 0.9714 | 1.0000 | 2.96e-12 | 6ifr:N |
2 | 6ifk:N | 34 | 34 | 1.0000 | 1.0000 | 1.0000 | 2.96e-12 | 6ifu:I, 6ify:I, 6ifz:I, 6ig0:N |
3 | 6ifl:J | 35 | 33 | 0.9706 | 0.9429 | 1.0000 | 1.07e-11 | 6ifr:J |
4 | 6ifn:N | 32 | 32 | 0.9412 | 1.0000 | 1.0000 | 3.83e-11 |