acgauugccccucacgaggggacagcugguaaugggauacc
The query sequence (length=41) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 7lys:B | 41 | 41 | 1.0000 | 1.0000 | 1.0000 | 5.14e-16 | |
2 | 7lyt:B | 39 | 39 | 0.9512 | 1.0000 | 1.0000 | 6.65e-15 | |
3 | 7m5o:B | 37 | 36 | 0.8780 | 0.9730 | 1.0000 | 3.09e-13 |