acaaucuucucaugagguguugaacgaaaauuuaaauuuaguuugaaaucgauuggugaaauuuuaccacuuugu
The query sequence (length=75) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8eth:6 | 75 | 75 | 1.0000 | 1.0000 | 1.0000 | 1.57e-34 | 8ev3:6 |
| 2 | 8esr:6 | 79 | 79 | 1.0000 | 0.9494 | 0.9494 | 5.69e-29 | |
| 3 | 8esq:6 | 81 | 81 | 1.0000 | 0.9259 | 0.9259 | 3.43e-26 | 8eti:6 |
| 4 | 8eup:6 | 55 | 55 | 0.7067 | 0.9636 | 0.9636 | 1.61e-19 |
zhanggroup.org