acaaucuucucacaugagguguugaacgaaaauuuaaauuuaguuugaaaucgau
The query sequence (length=55) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8eup:6 | 55 | 55 | 1.0000 | 1.0000 | 1.0000 | 1.36e-23 | |
| 2 | 8esr:6 | 79 | 55 | 1.0000 | 0.6962 | 1.0000 | 1.36e-23 | |
| 3 | 8esq:6 | 81 | 55 | 1.0000 | 0.6790 | 1.0000 | 1.36e-23 | 8eti:6 |
| 4 | 8eth:6 | 75 | 55 | 0.9636 | 0.7067 | 0.9636 | 1.06e-19 | 8ev3:6 |
| 5 | 8etg:6 | 62 | 53 | 0.8909 | 0.7903 | 0.9245 | 1.07e-14 |
zhanggroup.org