aacuugaaaaaguggcaccgagucggugcu
The query sequence (length=30) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 7z4g:A | 91 | 30 | 1.0000 | 0.3297 | 1.0000 | 3.79e-10 | |
2 | 8ygj:B | 136 | 30 | 1.0000 | 0.2206 | 1.0000 | 3.79e-10 | |
3 | 8ye9:C | 90 | 30 | 1.0000 | 0.3333 | 1.0000 | 3.79e-10 | |
4 | 8ye6:C | 92 | 30 | 1.0000 | 0.3261 | 1.0000 | 3.79e-10 | 7z4h:A |
5 | 5y36:B | 99 | 30 | 1.0000 | 0.3030 | 1.0000 | 3.79e-10 | |
6 | 8wus:B | 115 | 30 | 1.0000 | 0.2609 | 1.0000 | 3.79e-10 | |
7 | 7v59:C | 115 | 30 | 1.0000 | 0.2609 | 1.0000 | 3.79e-10 | 7v59:G |
8 | 8t78:B | 89 | 30 | 1.0000 | 0.3371 | 1.0000 | 3.79e-10 | |
9 | 8t77:B | 89 | 30 | 1.0000 | 0.3371 | 1.0000 | 3.79e-10 | 8t79:B |
10 | 8t6y:B | 88 | 30 | 1.0000 | 0.3409 | 1.0000 | 3.79e-10 | |
11 | 8t6t:B | 95 | 30 | 1.0000 | 0.3158 | 1.0000 | 3.79e-10 | |
12 | 8t6s:B | 90 | 30 | 1.0000 | 0.3333 | 1.0000 | 3.79e-10 | 7z4c:A |
13 | 8t6p:B | 88 | 30 | 1.0000 | 0.3409 | 1.0000 | 3.79e-10 | 8t76:B, 8t7s:H, 7z4e:A, 7z4k:A |
14 | 7s4v:B | 98 | 30 | 1.0000 | 0.3061 | 1.0000 | 3.79e-10 | 7s4x:B, 8spq:B, 8sqh:B, 8srs:B, 8t7s:B, 8tzz:B, 8u3y:B, 7z4j:A |
15 | 7s4u:B | 97 | 30 | 1.0000 | 0.3093 | 1.0000 | 3.79e-10 | |
16 | 7s3h:R | 30 | 30 | 1.0000 | 1.0000 | 1.0000 | 3.79e-10 | |
17 | 7s38:R | 87 | 30 | 1.0000 | 0.3448 | 1.0000 | 3.79e-10 | |
18 | 7s37:R | 46 | 30 | 1.0000 | 0.6522 | 1.0000 | 3.79e-10 | |
19 | 7s36:R | 87 | 30 | 1.0000 | 0.3448 | 1.0000 | 3.79e-10 | 8t6o:B |
20 | 4oo8:B | 97 | 30 | 1.0000 | 0.3093 | 1.0000 | 3.79e-10 | 4oo8:E |
21 | 6o0z:B | 96 | 30 | 1.0000 | 0.3125 | 1.0000 | 3.79e-10 | 8t6x:B, 7z4i:A, 7z4l:A |
22 | 6o0x:B | 98 | 30 | 1.0000 | 0.3061 | 1.0000 | 3.79e-10 | 6o0y:B |
23 | 8kal:E | 95 | 30 | 1.0000 | 0.3158 | 1.0000 | 3.79e-10 | |
24 | 8kak:A | 94 | 30 | 1.0000 | 0.3191 | 1.0000 | 3.79e-10 | 8kak:E, 8kal:A, 8kam:A |
25 | 8kah:I | 63 | 30 | 1.0000 | 0.4762 | 1.0000 | 3.79e-10 | 8kah:J, 8kai:I, 8kai:J, 8kaj:I, 8kaj:J |
26 | 8kag:A | 98 | 30 | 1.0000 | 0.3061 | 1.0000 | 3.79e-10 | |
27 | 6ifo:D | 90 | 30 | 1.0000 | 0.3333 | 1.0000 | 3.79e-10 | |
28 | 6ifo:C | 88 | 30 | 1.0000 | 0.3409 | 1.0000 | 3.79e-10 | 5xbl:B |
29 | 8g1i:B | 98 | 30 | 1.0000 | 0.3061 | 1.0000 | 3.79e-10 | |
30 | 8fzt:B | 69 | 30 | 1.0000 | 0.4348 | 1.0000 | 3.79e-10 | |
31 | 5f9r:A | 116 | 30 | 1.0000 | 0.2586 | 1.0000 | 3.79e-10 | 6mcb:B, 6mcc:B, 5vzl:B |
32 | 6aeb:A | 95 | 30 | 1.0000 | 0.3158 | 1.0000 | 3.79e-10 | 6aeb:E, 6aeg:A |
33 | 8wuv:B | 126 | 29 | 0.9667 | 0.2302 | 1.0000 | 1.36e-09 | |
34 | 8wuu:B | 111 | 29 | 0.9667 | 0.2613 | 1.0000 | 1.36e-09 | |
35 | 8wut:B | 112 | 29 | 0.9667 | 0.2589 | 1.0000 | 1.36e-09 |