tttgaaaagcaagcataaaagatctaaacataaaatctgta
The query sequence (length=41) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 7tjf:H | 41 | 41 | 1.0000 | 1.0000 | 1.0000 | 3.33e-17 | 7tjh:H, 7tji:H, 7tjj:H, 7tjk:H |
| 2 | 7tjf:G | 41 | 41 | 1.0000 | 1.0000 | 1.0000 | 3.33e-17 | 7tjh:G, 7tji:G, 7tjj:G, 7tjk:G |
| 3 | 7mca:H | 50 | 41 | 1.0000 | 0.8200 | 1.0000 | 3.33e-17 | |
| 4 | 7mca:G | 50 | 41 | 1.0000 | 0.8200 | 1.0000 | 3.33e-17 | |
| 5 | 7jgr:I | 34 | 34 | 0.8293 | 1.0000 | 1.0000 | 2.59e-13 | 7jk4:I |
| 6 | 7jgr:H | 34 | 34 | 0.8293 | 1.0000 | 1.0000 | 2.59e-13 | 7jk4:H |
| 7 | 7jk5:I | 32 | 32 | 0.7805 | 1.0000 | 1.0000 | 3.35e-12 | |
| 8 | 7jk5:H | 32 | 32 | 0.7805 | 1.0000 | 1.0000 | 3.35e-12 |
zhanggroup.org