ttcttactatttcttttttaactttcggaaatcaaatacactaatattttaa
The query sequence (length=52) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 6gys:G | 52 | 52 | 1.0000 | 1.0000 | 1.0000 | 3.31e-23 | |
| 2 | 6gys:F | 52 | 52 | 1.0000 | 1.0000 | 1.0000 | 3.31e-23 | |
| 3 | 8ow1:E | 153 | 48 | 0.9231 | 0.3137 | 1.0000 | 5.53e-21 | |
| 4 | 8ow1:D | 153 | 48 | 0.9231 | 0.3137 | 1.0000 | 5.53e-21 | |
| 5 | 7k7g:J | 123 | 48 | 0.9231 | 0.3902 | 1.0000 | 5.53e-21 | |
| 6 | 7k7g:I | 123 | 48 | 0.9231 | 0.3902 | 1.0000 | 5.53e-21 | |
| 7 | 7k78:J | 116 | 45 | 0.8654 | 0.3879 | 1.0000 | 2.57e-19 | |
| 8 | 7k78:I | 116 | 45 | 0.8654 | 0.3879 | 1.0000 | 2.57e-19 | |
| 9 | 8ow0:D | 121 | 33 | 0.6346 | 0.2727 | 1.0000 | 1.21e-12 | |
| 10 | 8ow0:E | 120 | 32 | 0.6154 | 0.2667 | 1.0000 | 4.34e-12 |
umich.edu