tgcgacggtctgacgctctacacagtgccagggggagataaacgaacgctgaacgctccgg
The query sequence (length=61) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8hvr:P | 61 | 61 | 1.0000 | 1.0000 | 1.0000 | 4.08e-28 | 8jke:P |
| 2 | 8hvr:O | 61 | 61 | 0.9016 | 0.9016 | 0.9016 | 4.14e-18 | 8jke:O |
| 3 | 8k60:H | 57 | 32 | 0.5246 | 0.5614 | 1.0000 | 5.39e-12 | |
| 4 | 8k60:G | 56 | 31 | 0.5082 | 0.5536 | 1.0000 | 1.94e-11 |
umich.edu