tcgccccccttcggtgctttgcaccgaaggggggc
The query sequence (length=35) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 7dbm:F | 38 | 35 | 1.0000 | 0.9211 | 1.0000 | 5.60e-14 | 6ik9:F, 6ika:F, 6kdm:F, 6kdn:F, 8x1z:F, 8x20:F, 8x21:F, 8x22:F, 5xn0:F, 5xn1:F, 5xn2:F |
2 | 7dbm:E | 35 | 35 | 1.0000 | 1.0000 | 1.0000 | 5.60e-14 | 6ik9:E, 6ika:E, 6kdm:E, 6kdn:E, 8x1z:E, 8x20:E, 8x21:E, 8x22:E, 5xn0:E, 5xn1:E, 5xn2:E |
3 | 7z24:E | 36 | 31 | 0.8857 | 0.8611 | 1.0000 | 9.37e-12 | 7z2d:E, 7z2g:E |
4 | 6vug:E | 34 | 31 | 0.8857 | 0.9118 | 1.0000 | 9.37e-12 | |
5 | 7ozw:F | 34 | 31 | 0.8857 | 0.9118 | 1.0000 | 9.37e-12 | 7p15:F |
6 | 6o9e:F | 35 | 31 | 0.8857 | 0.8857 | 1.0000 | 9.37e-12 | 6o9e:E |
7 | 5i3u:E | 36 | 31 | 0.8857 | 0.8611 | 1.0000 | 9.37e-12 | 5i3u:F |
8 | 5hlf:E | 35 | 31 | 0.8857 | 0.8857 | 1.0000 | 9.37e-12 | 5hlf:F, 5hp1:F, 5hp1:E, 5hro:E, 5hro:F, 5i42:E, 5i42:F, 7lri:E, 7lri:F, 7lsk:F, 7lsk:E |
9 | 7dbn:F | 38 | 31 | 0.8857 | 0.8158 | 1.0000 | 9.37e-12 | 6kdj:F, 6kdk:F, 6kdo:F |
10 | 7dbn:E | 35 | 31 | 0.8857 | 0.8857 | 1.0000 | 9.37e-12 | 6kdj:E, 6kdk:E, 6kdo:E, 7lrm:F, 7lrm:E, 7lrx:F, 7lrx:E, 7lry:F, 7lry:E |
11 | 5d3g:F | 36 | 31 | 0.8857 | 0.8611 | 1.0000 | 9.37e-12 | 5d3g:E, 7z29:E, 7z2e:E, 7z2h:E |