BioLiP

>dna
tcctcagtcgcgatcgaacactcgagccgagcagacgtgcctacg

The query sequence (length=45) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	5iy8:Y	83	45	1.0000	0.5422	1.0000	2.09e-19	5iy9:Y
2	5fur:F	80	45	1.0000	0.5625	1.0000	2.09e-19	6mzm:U
3	5fur:E	80	45	1.0000	0.5625	1.0000	2.09e-19	6mzm:V
4	7egj:Y	74	45	1.0000	0.6081	1.0000	2.09e-19
5	7egj:X	74	45	1.0000	0.6081	1.0000	2.09e-19
6	7egh:Y	45	45	1.0000	1.0000	1.0000	2.09e-19
7	7egh:X	45	45	1.0000	1.0000	1.0000	2.09e-19
8	7egd:Y	72	45	1.0000	0.6250	1.0000	2.09e-19
9	7egd:X	72	45	1.0000	0.6250	1.0000	2.09e-19
10	5iyc:Y	80	44	0.9778	0.5500	1.0000	7.51e-19	5iyd:Y
11	5iy7:Y	77	41	0.9111	0.5325	1.0000	3.49e-17
12	5iyb:Y	75	39	0.8667	0.5200	1.0000	4.52e-16
13	7eg9:Y	71	37	0.8222	0.5211	1.0000	5.84e-15
14	7eg9:X	71	37	0.8222	0.5211	1.0000	5.84e-15
15	7eg7:Y	71	36	0.8000	0.5070	1.0000	2.10e-14
16	7eg7:X	71	36	0.8000	0.5070	1.0000	2.10e-14
17	5iy7:X	77	34	0.7556	0.4416	1.0000	2.72e-13
18	7egb:Y	69	34	0.7556	0.4928	1.0000	2.72e-13	7ena:Y, 7enc:Y
19	7egb:X	69	34	0.7556	0.4928	1.0000	2.72e-13	7ena:X, 7enc:X
20	5iyb:X	75	32	0.7111	0.4267	1.0000	3.52e-12
21	5iy8:X	83	32	0.7111	0.3855	1.0000	3.52e-12	5iy9:X
22	5iyc:X	80	31	0.6889	0.3875	1.0000	1.27e-11	5iyd:X
23	5iy6:Y	65	29	0.6444	0.4462	1.0000	1.64e-10	6o9l:Y
24	5iy6:X	65	29	0.6444	0.4462	1.0000	1.64e-10	6o9l:X
25	7lbm:V	64	28	0.6222	0.4375	1.0000	5.89e-10
26	7lbm:U	64	28	0.6222	0.4375	1.0000	5.89e-10

[Back]