BioLiP

>dna
tacacccaagacaccaggcacgagacagaaaaaaacaaaa

The query sequence (length=40) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	8jh2:0	40	40	1.0000	1.0000	1.0000	1.15e-16
2	7xti:T	85	38	0.9500	0.4471	1.0000	1.49e-15
3	7xti:N	74	38	0.9500	0.5135	1.0000	1.49e-15
4	7xtd:T	123	38	0.9500	0.3089	1.0000	1.49e-15
5	7xtd:N	112	38	0.9500	0.3393	1.0000	1.49e-15
6	8jnd:J	153	38	0.9500	0.2484	1.0000	1.49e-15	8jne:J, 8xbt:J, 8xbu:J
7	8jnd:I	156	38	0.9500	0.2436	1.0000	1.49e-15	8jne:I, 8xbt:I, 8xbu:I
8	8jh3:T	159	38	0.9500	0.2390	1.0000	1.49e-15
9	6j4w:N	165	38	0.9500	0.2303	1.0000	1.49e-15
10	6j4w:T	171	38	0.9500	0.2222	1.0000	1.49e-15
11	6a5p:N	159	38	0.9500	0.2390	1.0000	1.49e-15
12	6a5p:T	168	38	0.9500	0.2262	1.0000	1.49e-15
13	6a5o:N	169	38	0.9500	0.2249	1.0000	1.49e-15
14	6a5o:T	178	38	0.9500	0.2135	1.0000	1.49e-15	8jh4:T
15	6j51:1	36	36	0.9000	1.0000	1.0000	1.93e-14
16	6j51:0	36	36	0.9000	1.0000	1.0000	1.93e-14
17	6j50:1	41	36	0.9000	0.8780	1.0000	1.93e-14
18	6j50:0	41	36	0.9000	0.8780	1.0000	1.93e-14
19	6a5u:1	40	36	0.9000	0.9000	1.0000	1.93e-14
20	6a5u:0	40	36	0.9000	0.9000	1.0000	1.93e-14
21	6a5l:1	42	36	0.9000	0.8571	1.0000	1.93e-14	6j4z:1
22	6a5l:0	42	36	0.9000	0.8571	1.0000	1.93e-14	6j4z:0
23	7wbv:T	159	38	0.9250	0.2327	0.9737	6.93e-14
24	8he5:T	154	38	0.9250	0.2403	0.9737	6.93e-14	7wbw:T
25	7wbv:N	154	33	0.8250	0.2143	1.0000	8.97e-13
26	6a5r:T	136	33	0.8250	0.2426	1.0000	8.97e-13
27	8he5:N	142	32	0.8000	0.2254	1.0000	3.23e-12
28	7xse:T	134	31	0.7750	0.2313	1.0000	1.16e-11
29	7xn7:T	53	31	0.7750	0.5849	1.0000	1.16e-11
30	7wbw:N	149	33	0.8000	0.2148	0.9697	4.17e-11

[Back]