BioLiP

>dna
gtttttttctgtctcgtgcctggtgtcttgggtgta

The query sequence (length=36) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	7xti:T	85	36	1.0000	0.4235	1.0000	1.63e-14
2	7xti:N	74	36	1.0000	0.4865	1.0000	1.63e-14
3	7xtd:T	123	36	1.0000	0.2927	1.0000	1.63e-14
4	7xtd:N	112	36	1.0000	0.3214	1.0000	1.63e-14
5	8jnd:J	153	36	1.0000	0.2353	1.0000	1.63e-14	8jne:J, 8xbt:J, 8xbu:J
6	8jnd:I	156	36	1.0000	0.2308	1.0000	1.63e-14	8jne:I, 8xbt:I, 8xbu:I
7	8jh3:T	159	36	1.0000	0.2264	1.0000	1.63e-14
8	8jh2:0	40	36	1.0000	0.9000	1.0000	1.63e-14
9	6j51:1	36	36	1.0000	1.0000	1.0000	1.63e-14
10	6j51:0	36	36	1.0000	1.0000	1.0000	1.63e-14
11	6j50:1	41	36	1.0000	0.8780	1.0000	1.63e-14
12	6j50:0	41	36	1.0000	0.8780	1.0000	1.63e-14
13	6j4w:N	165	36	1.0000	0.2182	1.0000	1.63e-14
14	6j4w:T	171	36	1.0000	0.2105	1.0000	1.63e-14
15	6a5u:1	40	36	1.0000	0.9000	1.0000	1.63e-14
16	6a5u:0	40	36	1.0000	0.9000	1.0000	1.63e-14
17	6a5p:N	159	36	1.0000	0.2264	1.0000	1.63e-14
18	6a5p:T	168	36	1.0000	0.2143	1.0000	1.63e-14
19	6a5o:N	169	36	1.0000	0.2130	1.0000	1.63e-14
20	6a5o:T	178	36	1.0000	0.2022	1.0000	1.63e-14	8jh4:T
21	6a5l:1	42	36	1.0000	0.8571	1.0000	1.63e-14	6j4z:1
22	6a5l:0	42	36	1.0000	0.8571	1.0000	1.63e-14	6j4z:0
23	7wbv:T	159	33	0.9167	0.2075	1.0000	7.59e-13
24	7wbv:N	154	33	0.9167	0.2143	1.0000	7.59e-13
25	8he5:T	154	36	0.9722	0.2273	0.9722	7.59e-13	7wbw:T
26	6a5r:T	136	33	0.9167	0.2426	1.0000	7.59e-13
27	8he5:N	142	32	0.8889	0.2254	1.0000	2.73e-12
28	7xse:T	134	31	0.8611	0.2313	1.0000	9.82e-12
29	7xn7:T	53	31	0.8611	0.5849	1.0000	9.82e-12
30	7wbw:N	149	33	0.8889	0.2148	0.9697	3.53e-11

[Back]