gggtattcgccgcgtacctctcctccgcaagtatcctattccttgcagcggt
The query sequence (length=52) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 6x43:P | 52 | 52 | 1.0000 | 1.0000 | 1.0000 | 3.31e-23 | |
| 2 | 6x26:P | 55 | 55 | 1.0000 | 0.9455 | 0.9455 | 9.26e-19 | 6x2f:P, 6x2n:P, 6x4w:P, 6x4y:P, 6x50:P |
| 3 | 6x50:Q | 49 | 52 | 0.8654 | 0.9184 | 0.8654 | 2.02e-10 | |
| 4 | 6x4w:Q | 48 | 28 | 0.5385 | 0.5833 | 1.0000 | 7.26e-10 | 6x4y:Q |
| 5 | 6x26:Q | 49 | 28 | 0.5385 | 0.5714 | 1.0000 | 7.26e-10 | 6x2f:Q, 6x2n:Q, 6x43:Q |
zhanggroup.org