gcttgacaaaagtgttaaattgtgctatact
The query sequence (length=31) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 5vi5:O | 49 | 31 | 1.0000 | 0.6327 | 1.0000 | 7.59e-12 | |
| 2 | 6cce:O | 57 | 31 | 1.0000 | 0.5439 | 1.0000 | 7.59e-12 | |
| 3 | 6bzo:O | 31 | 31 | 1.0000 | 1.0000 | 1.0000 | 7.59e-12 | 6c04:O, 6ccv:O, 6dcf:O, 6m7j:O, 5tw1:O, 5vi8:O, 6vvs:O, 6vvt:O, 6vvv:O |
| 4 | 4xlp:O | 30 | 30 | 0.9677 | 1.0000 | 1.0000 | 2.73e-11 | 4xlp:R, 4xlq:O, 4xlq:R, 4xls:O, 4xls:R |
| 5 | 4xln:O | 48 | 30 | 0.9677 | 0.6250 | 1.0000 | 2.73e-11 | 4xln:R, 4xlr:O, 4xlr:R |
umich.edu