gctgtatcactgtgtaagacaggccagatc
The query sequence (length=30) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 6v0v:I | 30 | 30 | 1.0000 | 1.0000 | 1.0000 | 2.57e-11 | |
| 2 | 6v0v:F | 30 | 30 | 1.0000 | 1.0000 | 1.0000 | 2.57e-11 | |
| 3 | 6oem:I | 46 | 30 | 1.0000 | 0.6522 | 1.0000 | 2.57e-11 | 6oen:I, 6oeo:I, 6oep:I, 6oeq:I, 6oer:I |
| 4 | 6cg0:F | 46 | 30 | 1.0000 | 0.6522 | 1.0000 | 2.57e-11 | 6cij:F, 6oem:F, 6oen:F, 6oeo:F, 6oep:F, 6oeq:F |
| 5 | 5zdz:F | 45 | 29 | 0.9667 | 0.6444 | 1.0000 | 9.23e-11 | 5ze0:F, 5ze1:F |
zhanggroup.org