gcgctttacagagaaacctcctcagcgcgc
The query sequence (length=30) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 2qoj:Y | 30 | 30 | 1.0000 | 1.0000 | 1.0000 | 2.57e-11 | |
| 2 | 3eh8:C | 31 | 30 | 1.0000 | 0.9677 | 1.0000 | 2.57e-11 | 3eh8:F, 3eh8:I |
| 3 | 3eh8:B | 31 | 30 | 1.0000 | 0.9677 | 1.0000 | 2.57e-11 | 3eh8:E, 3eh8:H |
| 4 | 2qoj:X | 29 | 28 | 0.9333 | 0.9655 | 1.0000 | 3.32e-10 |
zhanggroup.org