gcgcagttgtgctatgatattttacaacacactattatatacacagcgtgctactgtt
The query sequence (length=58) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 4v1n:T | 58 | 58 | 1.0000 | 1.0000 | 1.0000 | 1.78e-26 | 4v1o:T |
| 2 | 4v1n:N | 50 | 36 | 0.6207 | 0.7200 | 1.0000 | 3.01e-14 | 4v1o:N |
| 3 | 5fyw:T | 47 | 33 | 0.5690 | 0.7021 | 1.0000 | 1.40e-12 | |
| 4 | 5fyw:N | 47 | 33 | 0.5690 | 0.7021 | 1.0000 | 1.40e-12 |
zhanggroup.org