gcgacgccctgtcgctgagaagcgtttgcgtcgc
The query sequence (length=34) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 8tlg:X | 34 | 34 | 1.0000 | 1.0000 | 1.0000 | 1.92e-13 | |
2 | 8tlh:X | 32 | 32 | 0.9412 | 1.0000 | 1.0000 | 2.48e-12 | 8tlh:C, 8tlj:X, 8tlj:C, 8tlk:X, 8tlk:C |