gatctggcctgtcttacacagtgatacagcccttaacaaaaacccg
The query sequence (length=46) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 6oem:I | 46 | 46 | 1.0000 | 1.0000 | 1.0000 | 6.00e-20 | 6oen:I, 6oeo:I, 6oep:I, 6oeq:I, 6oer:I |
2 | 6cg0:F | 46 | 46 | 1.0000 | 1.0000 | 1.0000 | 6.00e-20 | 6cij:F, 6oem:F, 6oen:F, 6oeo:F, 6oep:F, 6oeq:F |
3 | 5zdz:F | 45 | 45 | 0.9783 | 1.0000 | 1.0000 | 2.16e-19 | 5ze0:F, 5ze1:F |
4 | 6oer:F | 46 | 46 | 0.9783 | 0.9783 | 0.9783 | 2.79e-18 | |
5 | 6cil:I | 37 | 37 | 0.8043 | 1.0000 | 1.0000 | 6.04e-15 | |
6 | 6cil:F | 37 | 37 | 0.8043 | 1.0000 | 1.0000 | 6.04e-15 | |
7 | 6cik:I | 35 | 35 | 0.7609 | 1.0000 | 1.0000 | 7.81e-14 | |
8 | 6cik:F | 35 | 35 | 0.7609 | 1.0000 | 1.0000 | 7.81e-14 | 6cim:F |
9 | 6oet:F | 50 | 46 | 0.8913 | 0.8200 | 0.8913 | 1.31e-11 | |
10 | 5ze2:F | 30 | 30 | 0.6522 | 1.0000 | 1.0000 | 4.70e-11 | |
11 | 6v0v:I | 30 | 30 | 0.6522 | 1.0000 | 1.0000 | 4.70e-11 | |
12 | 6v0v:F | 30 | 30 | 0.6522 | 1.0000 | 1.0000 | 4.70e-11 | |
13 | 6cg0:L | 30 | 30 | 0.6522 | 1.0000 | 1.0000 | 4.70e-11 | 6cij:L, 6oet:L, 5zdz:L, 5ze0:L, 5ze1:L, 5ze2:L |