Home Research COVID-19 Services Publications People Teaching Job Opening News Forum Lab Only
Online Services

●I-TASSER ●I-TASSER-MTD ●C-I-TASSER ●CR-I-TASSER ●QUARK ●C-QUARK ●LOMETS ●MUSTER ●CEthreader ●SEGMER ●DeepFold ●DeepFoldRNA ●FoldDesign ●COFACTOR ●COACH ●MetaGO ●TripletGO ●IonCom ●FG-MD ●ModRefiner ●REMO ●DEMO ●DEMO-EM ●SPRING ●COTH ●Threpp ●PEPPI ●BSpred ●ANGLOR ●EDock ●BSP-SLIM ●SAXSTER ●FUpred ●ThreaDom ●ThreaDomEx ●EvoDesign ●BindProf ●BindProfX ●SSIPe ●GPCR-I-TASSER ●MAGELLAN ●ResQ ●STRUM ●DAMpred

●TM-score ●TM-align ●US-align ●MM-align ●RNA-align ●NW-align ●LS-align ●EDTSurf ●MVP ●MVP-Fit ●SPICKER ●HAAD ●PSSpred ●3DRobot ●MR-REX ●I-TASSER-MR ●SVMSEQ ●NeBcon ●ResPRE ●TripletRes ●DeepPotential ●WDL-RF ●ATPbind ●DockRMSD ●DeepMSA ●FASPR ●EM-Refiner ●GPU-I-TASSER

●BioLiP ●E. coli ●GLASS ●GPCR-HGmod ●GPCR-RD ●GPCR-EXP ●Tara-3D ●TM-fold ●DECOYS ●POTENTIAL ●RW/RWplus ●EvoEF ●HPSF ●THE-DB ●ADDRESS ●Alpaca-Antibody ●CASP7 ●CASP8 ●CASP9 ●CASP10 ●CASP11 ●CASP12 ●CASP13 ●CASP14

BioLiP
>dna
gagttcttcttcatacttcgagccgagcagacgtgcctacgga

The query sequence (length=43) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

# Hit Hit
length 		Aligned
length 		Identity
(normalized by query) 		Identity
(normalized by hit) 		Identity (normalized
by aligned length) 		E-value Homologs
to hit
1 8wav:X 43 43 1.0000 1.0000 1.0000 2.52e-18
2 8wau:X 43 42 0.9767 0.9767 1.0000 9.06e-18
3 8waw:X 43 42 0.9535 0.9535 0.9762 4.22e-16
4 8wat:X 43 41 0.9302 0.9302 0.9756 1.52e-15
5 8wav:Y 54 37 0.8140 0.6481 0.9459 4.25e-11
6 8was:Y 73 30 0.6977 0.4110 1.0000 4.25e-11
7 8was:X 63 30 0.6977 0.4762 1.0000 4.25e-11
8 8war:Y 73 30 0.6977 0.4110 1.0000 4.25e-11
9 8war:X 63 30 0.6977 0.4762 1.0000 4.25e-11
10 8waq:Y 73 30 0.6977 0.4110 1.0000 4.25e-11
11 8waq:X 63 30 0.6977 0.4762 1.0000 4.25e-11
12 8wau:Y 54 29 0.6744 0.5370 1.0000 1.53e-10
13 8wap:Y 73 29 0.6744 0.3973 1.0000 1.53e-10
14 8wap:X 63 29 0.6744 0.4603 1.0000 1.53e-10
15 8waw:Y 54 28 0.6512 0.5185 1.0000 5.49e-10
16 8wat:Y 54 28 0.6512 0.5185 1.0000 5.49e-10
17 8wao:Y 73 35 0.7674 0.4521 0.9429 5.49e-10
18 8wao:X 63 35 0.7674 0.5238 0.9429 5.49e-10

[Back]
Reference:
  • Chengxin Zhang, Xi Zhang, Peter L Freddolino, and Yang Zhang. BioLiP2: an updated structure database for biologically relevent ligand-protein interactions, Nucleic Acids Research, gkad630 (2023)(download the PDF file).
  • Jianyi Yang, Ambrish Roy, and Yang Zhang. BioLiP: a semi-manually curated database for biologically relevant ligand-protein interactions, Nucleic Acids Research, 41: D1096-D1103 (2013) (download the PDF file).

    • zhanglabzhanggroup.org | +65-6601-1241 | Computing 1, 13 Computing Drive, Singapore 117417