gagcgttcagcgttcgtttatctccccctggtataatgggagctgtcacggatgca
The query sequence (length=56) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8k60:G | 56 | 56 | 1.0000 | 1.0000 | 1.0000 | 2.19e-25 | |
| 2 | 8k60:H | 57 | 32 | 0.5714 | 0.5614 | 1.0000 | 4.81e-12 | |
| 3 | 8hvr:P | 61 | 31 | 0.5536 | 0.5082 | 1.0000 | 1.73e-11 | 8jke:P |
| 4 | 8hvr:O | 61 | 31 | 0.5536 | 0.5082 | 1.0000 | 1.73e-11 | 8jke:O |
| 5 | 8gzg:1 | 50 | 28 | 0.5000 | 0.5600 | 1.0000 | 8.04e-10 |
zhanggroup.org