gaaggggggctataaaagggggtgggggcgcgttcgtcctcactctcttccgcatcgctgtctg
The query sequence (length=64) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 7nvr:T | 64 | 64 | 1.0000 | 1.0000 | 1.0000 | 9.35e-30 | 7nvy:T, 7nvz:T |
| 2 | 7nvr:N | 64 | 64 | 1.0000 | 1.0000 | 1.0000 | 9.35e-30 | 7nvy:N, 7nvz:N |
| 3 | 8bvw:T | 206 | 60 | 0.9375 | 0.2913 | 1.0000 | 1.56e-27 | |
| 4 | 8bvw:N | 206 | 60 | 0.9375 | 0.2913 | 1.0000 | 1.56e-27 |
zhanggroup.org