BioLiP

>dna
gaagggcgcctataaaagggggtgggggcgcgttcgtcctcagtcgcgatcgaacactcgagccg

The query sequence (length=65) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	5iyc:Y	80	65	1.0000	0.8125	1.0000	2.65e-30	5iyd:Y
2	5iyb:Y	75	65	1.0000	0.8667	1.0000	2.65e-30
3	5iy7:Y	77	65	1.0000	0.8442	1.0000	2.65e-30
4	5iy6:Y	65	65	1.0000	1.0000	1.0000	2.65e-30	6o9l:Y
5	5iy6:X	65	65	1.0000	1.0000	1.0000	2.65e-30	6o9l:X
6	7lbm:V	64	64	0.9846	1.0000	1.0000	9.54e-30
7	7lbm:U	64	64	0.9846	1.0000	1.0000	9.54e-30
8	7egb:Y	69	64	0.9846	0.9275	1.0000	9.54e-30	7ena:Y, 7enc:Y
9	7egb:X	69	64	0.9846	0.9275	1.0000	9.54e-30	7ena:X, 7enc:X
10	7eg7:Y	71	64	0.9846	0.9014	1.0000	9.54e-30
11	7eg7:X	71	64	0.9846	0.9014	1.0000	9.54e-30
12	5fur:F	80	63	0.9692	0.7875	1.0000	3.43e-29	6mzm:U
13	5fur:E	80	63	0.9692	0.7875	1.0000	3.43e-29	6mzm:V
14	7eg9:Y	71	63	0.9692	0.8873	1.0000	3.43e-29
15	7eg9:X	71	63	0.9692	0.8873	1.0000	3.43e-29
16	5iy8:Y	83	65	0.9846	0.7711	0.9846	1.23e-28	5iy9:Y
17	5iya:Y	59	59	0.9077	1.0000	1.0000	5.74e-27
18	5iya:X	59	59	0.9077	1.0000	1.0000	5.74e-27
19	7egj:Y	74	57	0.8769	0.7703	1.0000	7.42e-26
20	7egj:X	74	57	0.8769	0.7703	1.0000	7.42e-26
21	7egd:Y	72	56	0.8615	0.7778	1.0000	2.67e-25
22	7egd:X	72	56	0.8615	0.7778	1.0000	2.67e-25
23	8gxq:Y	67	66	0.9538	0.9254	0.9394	1.24e-23	8gxs:Y
24	8gxq:X	67	66	0.9538	0.9254	0.9394	1.24e-23	8gxs:X
25	5iyb:X	75	67	0.8923	0.7733	0.8657	2.71e-15
26	5iy7:X	77	67	0.8923	0.7532	0.8657	2.71e-15
27	7nvt:T	50	45	0.6462	0.8400	0.9333	3.50e-14
28	7nvt:N	50	42	0.6154	0.8000	0.9524	3.50e-14
29	7nvs:T	49	45	0.6462	0.8571	0.9333	3.50e-14
30	7nvs:N	49	42	0.6154	0.8163	0.9524	3.50e-14
31	7nvr:T	64	45	0.6462	0.6562	0.9333	3.50e-14	7nvy:T, 7nvz:T
32	7nvr:N	64	42	0.6154	0.6250	0.9524	3.50e-14	7nvy:N, 7nvz:N
33	8byq:T	198	45	0.6462	0.2121	0.9333	3.50e-14	8bz1:T
34	8byq:N	198	42	0.6154	0.2020	0.9524	3.50e-14	8bz1:N
35	8bvw:T	206	45	0.6462	0.2039	0.9333	3.50e-14
36	8bvw:N	206	42	0.6154	0.1942	0.9524	3.50e-14
37	5iyc:X	80	30	0.4615	0.3750	1.0000	7.58e-11	5iyd:X
38	5iy8:X	83	30	0.4615	0.3614	1.0000	7.58e-11	5iy9:X
39	7egh:Y	45	29	0.4462	0.6444	1.0000	2.73e-10
40	7egh:X	45	29	0.4462	0.6444	1.0000	2.73e-10

[Back]