BioLiP

>dna
gaagggcgcctataaaagggggtgggggcgcgttcgtcctcagtcgcgatcgaacactc

The query sequence (length=59) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	7lbm:V	64	59	1.0000	0.9219	1.0000	5.05e-27
2	7lbm:U	64	59	1.0000	0.9219	1.0000	5.05e-27
3	5iyc:Y	80	59	1.0000	0.7375	1.0000	5.05e-27	5iyd:Y
4	5iyb:Y	75	59	1.0000	0.7867	1.0000	5.05e-27
5	5iya:Y	59	59	1.0000	1.0000	1.0000	5.05e-27
6	5iya:X	59	59	1.0000	1.0000	1.0000	5.05e-27
7	5iy7:Y	77	59	1.0000	0.7662	1.0000	5.05e-27
8	5iy6:Y	65	59	1.0000	0.9077	1.0000	5.05e-27	6o9l:Y
9	5iy6:X	65	59	1.0000	0.9077	1.0000	5.05e-27	6o9l:X
10	7egb:Y	69	58	0.9831	0.8406	1.0000	1.82e-26	7ena:Y, 7enc:Y
11	7egb:X	69	58	0.9831	0.8406	1.0000	1.82e-26	7ena:X, 7enc:X
12	7eg7:Y	71	58	0.9831	0.8169	1.0000	1.82e-26
13	7eg7:X	71	58	0.9831	0.8169	1.0000	1.82e-26
14	5fur:F	80	57	0.9661	0.7125	1.0000	6.53e-26	6mzm:U
15	5fur:E	80	57	0.9661	0.7125	1.0000	6.53e-26	6mzm:V
16	7eg9:Y	71	57	0.9661	0.8028	1.0000	6.53e-26
17	7eg9:X	71	57	0.9661	0.8028	1.0000	6.53e-26
18	5iy8:Y	83	59	0.9831	0.6988	0.9831	2.35e-25	5iy9:Y
19	7egj:Y	74	51	0.8644	0.6892	1.0000	1.41e-22
20	7egj:X	74	51	0.8644	0.6892	1.0000	1.41e-22
21	7egd:Y	72	50	0.8475	0.6944	1.0000	5.09e-22
22	7egd:X	72	50	0.8475	0.6944	1.0000	5.09e-22
23	8gxq:Y	67	60	0.9492	0.8358	0.9333	2.37e-20	8gxs:Y
24	8gxq:X	67	60	0.9492	0.8358	0.9333	2.37e-20	8gxs:X
25	7nvt:T	50	45	0.7119	0.8400	0.9333	3.08e-14
26	7nvt:N	50	42	0.6780	0.8000	0.9524	3.08e-14
27	7nvs:T	49	45	0.7119	0.8571	0.9333	3.08e-14
28	7nvs:N	49	42	0.6780	0.8163	0.9524	3.08e-14
29	7nvr:T	64	45	0.7119	0.6562	0.9333	3.08e-14	7nvy:T, 7nvz:T
30	7nvr:N	64	42	0.6780	0.6250	0.9524	3.08e-14	7nvy:N, 7nvz:N
31	8byq:T	198	45	0.7119	0.2121	0.9333	3.08e-14	8bz1:T
32	8byq:N	198	42	0.6780	0.2020	0.9524	3.08e-14	8bz1:N
33	8bvw:T	206	45	0.7119	0.2039	0.9333	3.08e-14
34	8bvw:N	206	42	0.6780	0.1942	0.9524	3.08e-14
35	5iyb:X	75	32	0.5424	0.4267	1.0000	5.16e-12
36	5iy7:X	77	32	0.5424	0.4156	1.0000	5.16e-12
37	5iyc:X	80	30	0.5085	0.3750	1.0000	6.67e-11	5iyd:X
38	5iy8:X	83	30	0.5085	0.3614	1.0000	6.67e-11	5iy9:X

[Back]