BioLiP

>dna
gaagggcgcctataaaagggggtgggggcgcgttcgtccgcacggccgatcgaacactcgagccgag

The query sequence (length=67) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	8gxq:Y	67	67	1.0000	1.0000	1.0000	2.13e-31	8gxs:Y
2	8gxq:X	67	67	1.0000	1.0000	1.0000	2.13e-31	8gxs:X
3	5iyc:Y	80	68	0.9552	0.8000	0.9412	9.99e-25	5iyd:Y
4	5iyb:Y	75	68	0.9552	0.8533	0.9412	9.99e-25
5	5iy7:Y	77	68	0.9552	0.8312	0.9412	9.99e-25
6	7egb:Y	69	67	0.9403	0.9130	0.9403	3.59e-24	7ena:Y, 7enc:Y
7	7egb:X	69	67	0.9403	0.9130	0.9403	3.59e-24	7ena:X, 7enc:X
8	7eg7:Y	71	67	0.9403	0.8873	0.9403	3.59e-24
9	7eg7:X	71	67	0.9403	0.8873	0.9403	3.59e-24
10	5iy6:Y	65	66	0.9254	0.9538	0.9394	1.29e-23	6o9l:Y
11	5iy6:X	65	66	0.9254	0.9538	0.9394	1.29e-23	6o9l:X
12	5fur:F	80	66	0.9254	0.7750	0.9394	1.29e-23	6mzm:U
13	5fur:E	80	66	0.9254	0.7750	0.9394	1.29e-23	6mzm:V
14	7eg9:Y	71	66	0.9254	0.8732	0.9394	1.29e-23
15	7eg9:X	71	66	0.9254	0.8732	0.9394	1.29e-23
16	7lbm:V	64	65	0.9104	0.9531	0.9385	4.65e-23
17	7lbm:U	64	65	0.9104	0.9531	0.9385	4.65e-23
18	5iya:Y	59	60	0.8358	0.9492	0.9333	2.80e-20
19	5iya:X	59	60	0.8358	0.9492	0.9333	2.80e-20
20	7egj:Y	74	60	0.8358	0.7568	0.9333	2.80e-20
21	7egj:X	74	60	0.8358	0.7568	0.9333	2.80e-20
22	7egd:Y	72	59	0.8209	0.7639	0.9322	1.01e-19
23	7egd:X	72	59	0.8209	0.7639	0.9322	1.01e-19
24	7nvt:T	50	43	0.5970	0.8000	0.9302	4.71e-13
25	7nvt:N	50	43	0.5970	0.8000	0.9302	4.71e-13
26	7nvs:T	49	43	0.5970	0.8163	0.9302	4.71e-13
27	7nvs:N	49	43	0.5970	0.8163	0.9302	4.71e-13
28	7nvr:T	64	43	0.5970	0.6250	0.9302	4.71e-13	7nvy:T, 7nvz:T
29	7nvr:N	64	43	0.5970	0.6250	0.9302	4.71e-13	7nvy:N, 7nvz:N
30	5iyb:X	75	69	0.8657	0.7733	0.8406	4.71e-13
31	5iy7:X	77	69	0.8657	0.7532	0.8406	4.71e-13
32	8byq:T	198	43	0.5970	0.2020	0.9302	4.71e-13	8bz1:T
33	8byq:N	198	43	0.5970	0.2020	0.9302	4.71e-13	8bz1:N
34	8bvw:T	206	43	0.5970	0.1942	0.9302	4.71e-13
35	8bvw:N	206	43	0.5970	0.1942	0.9302	4.71e-13
36	5iyc:X	80	30	0.4478	0.3750	1.0000	7.89e-11	5iyd:X
37	5iy8:X	83	30	0.4478	0.3614	1.0000	7.89e-11	5iy9:X

[Back]