BioLiP

>dna
gaagggcgcctataaaagggggtgggggcgcgaattttttttttcgcgatcgaacactcgagccgagcagacgtgcc

The query sequence (length=77) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	5iy7:X	77	77	1.0000	1.0000	1.0000	7.02e-37
2	5iyb:X	75	75	0.9740	1.0000	1.0000	9.08e-36
3	5iyc:Y	80	77	0.8831	0.8500	0.8831	7.17e-22	5iyd:Y
4	5iyc:X	80	77	0.8831	0.8500	0.8831	7.17e-22	5iyd:X
5	5iy8:X	83	77	0.8831	0.8193	0.8831	7.17e-22	5iy9:X
6	5iy7:Y	77	77	0.8831	0.8831	0.8831	7.17e-22
7	5iyb:Y	75	75	0.8571	0.8800	0.8800	9.27e-21
8	5fur:F	80	75	0.8571	0.8250	0.8800	9.27e-21	6mzm:U
9	5fur:E	80	75	0.8571	0.8250	0.8800	9.27e-21	6mzm:V
10	5iy8:Y	83	77	0.8701	0.8072	0.8701	3.33e-20	5iy9:Y
11	7eg9:Y	71	71	0.8052	0.8732	0.8732	1.55e-18
12	7eg9:X	71	73	0.8312	0.9014	0.8767	1.55e-18
13	7eg7:Y	71	73	0.8312	0.9014	0.8767	1.55e-18
14	7eg7:X	71	73	0.8312	0.9014	0.8767	1.55e-18
15	7egj:Y	74	69	0.7792	0.8108	0.8696	2.01e-17
16	7egj:X	74	69	0.7792	0.8108	0.8696	2.01e-17
17	7egb:Y	69	71	0.8052	0.8986	0.8732	2.01e-17	7ena:Y, 7enc:Y
18	7egb:X	69	71	0.8052	0.8986	0.8732	2.01e-17	7ena:X, 7enc:X
19	7egd:Y	72	68	0.7662	0.8194	0.8676	7.22e-17
20	7egd:X	72	68	0.7662	0.8194	0.8676	7.22e-17
21	5iy6:Y	65	67	0.7532	0.8923	0.8657	3.36e-15	6o9l:Y
22	5iy6:X	65	67	0.7532	0.8923	0.8657	3.36e-15	6o9l:X
23	7lbm:V	64	66	0.7403	0.8906	0.8636	1.21e-14
24	7lbm:U	64	66	0.7403	0.8906	0.8636	1.21e-14
25	8gxq:Y	67	69	0.7532	0.8657	0.8406	5.62e-13	8gxs:Y
26	8gxq:X	67	69	0.7532	0.8657	0.8406	5.62e-13	8gxs:X
27	7egh:Y	45	34	0.4416	0.7556	1.0000	5.62e-13
28	7egh:X	45	34	0.4416	0.7556	1.0000	5.62e-13
29	5iya:Y	59	61	0.6753	0.8814	0.8525	7.27e-12
30	5iya:X	59	32	0.4156	0.5424	1.0000	7.27e-12

[Back]