BioLiP

>dna
gaagggcgcctataaaagggggtgggggcgcgaattttttttttcgcgatcgaacactcgagccgagcagacgtg

The query sequence (length=75) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	5iyb:X	75	75	1.0000	1.0000	1.0000	8.78e-36
2	5iy7:X	77	75	1.0000	0.9740	1.0000	8.78e-36
3	5iyc:Y	80	75	0.8800	0.8250	0.8800	8.97e-21	5iyd:Y
4	5iyc:X	80	75	0.8800	0.8250	0.8800	8.97e-21	5iyd:X
5	5iyb:Y	75	75	0.8800	0.8800	0.8800	8.97e-21
6	5iy8:X	83	75	0.8800	0.7952	0.8800	8.97e-21	5iy9:X
7	5iy7:Y	77	75	0.8800	0.8571	0.8800	8.97e-21
8	5fur:F	80	73	0.8533	0.8000	0.8767	1.16e-19	6mzm:U
9	5fur:E	80	73	0.8533	0.8000	0.8767	1.16e-19	6mzm:V
10	5iy8:Y	83	75	0.8667	0.7831	0.8667	4.17e-19	5iy9:Y
11	7eg9:Y	71	71	0.8267	0.8732	0.8732	1.50e-18
12	7eg9:X	71	73	0.8533	0.9014	0.8767	1.50e-18
13	7eg7:Y	71	73	0.8533	0.9014	0.8767	1.50e-18
14	7eg7:X	71	73	0.8533	0.9014	0.8767	1.50e-18
15	7egb:Y	69	71	0.8267	0.8986	0.8732	1.94e-17	7ena:Y, 7enc:Y
16	7egb:X	69	71	0.8267	0.8986	0.8732	1.94e-17	7ena:X, 7enc:X
17	7egj:Y	74	67	0.7733	0.7838	0.8657	2.51e-16
18	7egj:X	74	67	0.7733	0.7838	0.8657	2.51e-16
19	7egd:Y	72	66	0.7600	0.7917	0.8636	9.04e-16
20	7egd:X	72	66	0.7600	0.7917	0.8636	9.04e-16
21	5iy6:Y	65	67	0.7733	0.8923	0.8657	3.25e-15	6o9l:Y
22	5iy6:X	65	67	0.7733	0.8923	0.8657	3.25e-15	6o9l:X
23	7lbm:V	64	66	0.7600	0.8906	0.8636	1.17e-14
24	7lbm:U	64	66	0.7600	0.8906	0.8636	1.17e-14
25	8gxq:Y	67	69	0.7733	0.8657	0.8406	5.44e-13	8gxs:Y
26	8gxq:X	67	69	0.7733	0.8657	0.8406	5.44e-13	8gxs:X
27	5iya:Y	59	61	0.6933	0.8814	0.8525	7.04e-12
28	5iya:X	59	32	0.4267	0.5424	1.0000	7.04e-12
29	7egh:Y	45	32	0.4267	0.7111	1.0000	7.04e-12
30	7egh:X	45	32	0.4267	0.7111	1.0000	7.04e-12

[Back]